Top » Catalog » SNPs » A11105

$17.50

A11105
[A11105]

A11105
HG19 Position: ChrY:22553522..22553522
Ancestral: ins
Derived: del
Reference: Richard McDevitt (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11105_F ATTTGCTTGTGTTGCTGTGC
Reverse Primer: A11105_R TGGGGTCACTATGGTTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies