Top » Catalog » SNPs » A11106

$18.00

A11106
[A11106]

A11106
hg38 Position: ChrY:17039403..17039403
Ancestral: G
Derived: A
Reference: Richard McDevitt (2016)
ISOGG Haplogroup: R1b
Comments: M222 > DF105 > DF85 > S673 > DF97 > A11230
Forward Primer: A11106_F AGTTGTCCGGTCTGGTTTTG
Reverse Primer: A11106_R TGCTGGAAATGTCACCAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies