Top » Catalog » SNPs » A11107

$18.00

A11107
[A11107]

A11107
HG19 Position: ChrY:14555413..14555413
Ancestral: C
Derived: T
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11107_F GAATGTTTTAGTCCATTCGGATTG
Reverse Primer: A11107_R GAAATAGGACTGGAACTGAAAATATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11113
$18.00
Haplogroup Info
Other products
Currencies