Top » Catalog » SNPs » A11108

$17.50

A11108
[A11108]

A11108
HG19 Position: ChrY:21922358..21922358
Ancestral: T
Derived: C
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11108_F CGGTTCTCCATTTCGTTTGTAG
Reverse Primer: A11108_R CAGAAAGCAAAGACCATTATCAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies