Top » Catalog » SNPs » A11110

$18.00

A11110
[A11110]

A11110
HG19 Position: ChrY:9813710..9813710
Ancestral: G
Derived: A
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11110_F ACAGCCAAACAGAGCACATG
Reverse Primer: A11110_R TGAGTAATCACTGTGGGGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies