Top » Catalog » SNPs » A11112

$18.00

A11112
[A11112]

A11112
HG19 Position: ChrY:16245591..16245591
Ancestral: G
Derived: T
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11112_F GAAATATGGCCTCATGGGATG
Reverse Primer: A11112_R ACCTGCACTGGTACCGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies