Top » Catalog » SNPs » A11113

$17.50

A11113
[A11113]

A11113
HG19 Position: ChrY:17459437..17459437
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Downstream of L1498
Forward Primer: A11113_F TGTGATGGGCATCTTCATTG
Reverse Primer: A11113_R TGTGGAGGAACATTTTGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies