Top » Catalog » SNPs » A11115

$17.50

A11115
[A11115]

A11115
HG19 Position: ChrY:7650081..7650081
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Downstream of L161
Forward Primer: A11115_F CTTGGATGCAGGCGAGAG
Reverse Primer: A11115_R GGGTGATTTTGGGACGATTC
Reviews

Customers who bought this product also purchased
Y12075
Y12075
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies