Top » Catalog » SNPs » A11116

$18.00

A11116
[A11116]

A11116
HG19 Position: ChrY:7960879..7960879
Ancestral: G
Derived: A
Reference: Kim Fields (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of Z16429
Forward Primer: A11116_F ATGTAGAAGTAGGCACAGGTAGACAG
Reverse Primer: A11116_R ATGGGCATGATAATGATTCTCC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies