Top » Catalog » SNPs » A11119

$17.50

A11119
[A11119]

A11119
HG19 Position: ChrY:7695188..7695188
Ancestral: G
Derived: T
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11119_F TGGGTGCTCTCAAAGCTAGG
Reverse Primer: A11119_R TGCTTTTTCCTGTGGGTAGC
Reviews

Customers who bought this product also purchased
A11118
A11118
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies