Top » Catalog » SNPs » A11122

$18.00

A11122
[A11122]

A11122
HG19 Position: ChrY:14908643..14908643
Ancestral: G
Derived: A
Reference: John Orr (2016)
ISOGG Haplogroup: R1a1a1b1a3a (not listed)
Comments: Below A11125.
Forward Primer: A11122_F GACACTACTAGCATCTACGATGATGG
Reverse Primer: A11122_R GTCATGTTCACACAAACATGATG
Reviews

Customers who bought this product also purchased
A11124
A11124
A11123
A11123
A11126
A11126
A11125
A11125
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1065
$18.00
Haplogroup Info
Other products
Currencies