Top » Catalog » SNPs » A11125

$18.00

A11125
[A11125]

A11125
hg38 Position: ChrY:17168775..17168775
Ancestral: G
Derived: A
Reference: John Orr (2016)
ISOGG Haplogroup: R1a1a1b1a3a (not listed)
Comments: Below YP609.
Forward Primer: A11125_F AGGACATAAGCTATTGGGGTTG
Reverse Primer: A11125_R GCTAGCACTGGGAGAAATGC
Reviews

Customers who bought this product also purchased
A11124
A11124
A11123
A11123
A11122
A11122
A11126
A11126
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies