Top » Catalog » SNPs » A11126

$18.00

A11126
[A11126]

A11126
HG19 Position: ChrY:22374544..22374544
Ancestral: C
Derived: G
Reference: John Orr (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A11126_F CTGTGCTAAATGTCATATCTCTTCG
Reverse Primer: A11126_R GATGTCCAATCAGGAAAATAATTTC
Reviews

Customers who bought this product also purchased
A11123
A11123
A11122
A11122
A11125
A11125
A11124
A11124
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies