Top » Catalog » SNPs » A11218

$18.00

A11218
[A11218]

A11218
hg38 Position: ChrY:12349951..12349951
Ancestral: G
Derived: A
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11218_F ATGTGTTCAAGGCTGCACTG
Reverse Primer: A11218_R GGGAGTTGAGATTCCTGAGAACTAG
Reviews

Customers who bought this product also purchased
A11222
A11222
A11221
A11221
A11220
A11220
A11219
A11219
R1b-A541 Aber Panel
R1b-A541 Aber Panel
A9429
A9429
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies