Top » Catalog » SNPs » A11218

$18.00

A11218
[A11218]

A11218
hg38 Position: ChrY:12349951..12349951
Ancestral: G
Derived: A
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11218_F ATGTGTTCAAGGCTGCACTG
Reverse Primer: A11218_R GGGAGTTGAGATTCCTGAGAACTAG
Reviews

Customers who bought this product also purchased
A11221
A11221
A11220
A11220
A11219
A11219
A11222
A11222
A9428
A9428
A541
A541
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies