Top » Catalog » SNPs » A11220

$18.00

A11220
[A11220]

A11220
HG19 Position: ChrY:18753082..18753082
Ancestral: G
Derived: T
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11220_F GGCTTTGTCAAATATTGTAGTCCTG
Reverse Primer: A11220_R CACCATCTTCAGGGATGTGG
Reviews

Customers who bought this product also purchased
A11218
A11218
A11222
A11222
A11221
A11221
A11219
A11219
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies