Top » Catalog » SNPs » A11222

$18.00

A11222
[A11222]

A11222
hg38 Position: ChrY:19992465..19992465
Ancestral: A
Derived: G
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11222_F GTGAAGTATTTTATTTCTCCTTCACTTAAGT
Reverse Primer: A11222_R GCCTCAGTAGCCGATGTGAC
Reviews

Customers who bought this product also purchased
R1b-A541 Aber Panel
R1b-A541 Aber Panel
A9429
A9429
A9428
A9428
A9427
A9427
A9426
A9426
A9450
A9450
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies