Top » Catalog » SNPs » A11222

$18.00

A11222
[A11222]

A11222
HG19 Position: ChrY:19992465..19992465
Ancestral: A
Derived: G
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11222_F GTGAAGTATTTTATTTCTCCTTCACTTAAGT
Reverse Primer: A11222_R GCCTCAGTAGCCGATGTGAC
Reviews

Customers who bought this product also purchased
A11218
A11218
A11220
A11220
A11219
A11219
A11221
A11221
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies