Top » Catalog » SNPs » YP5253

$18.00

YP5253
[YP5253]

YP5253
hg38 Position: ChrY:9289259..9289259
Ancestral: G
Derived: A
Reference: YDNA-community (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: Below M458 > L260 > YP1337
Forward Primer: YP5253_F CTGACTTTATTGCTGCTTACACTCTAG
Reverse Primer: YP5253_R TGTGTGCACCTGCAAGTGA
Reviews

Customers who bought this product also purchased
Z4624
Z4624
YP258
YP258
BY207879
BY207879
Y107244
Y107244
DYS576
DYS576
YP5248
YP5248
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies