Top » Catalog » SNPs » A10103

$18.00

A10103
[A10103]

A10103
HG19 Position: ChrY:7935412..7935412
Ancestral: A
Derived: T
Reference: Alex Williamson (2015)
ISOGG Haplogroup: R1b
Comments: Below DF49
Forward Primer: A10103_F ACAACGCTAATTCTTATTCTACAAACTG
Reverse Primer: A10103_R TTTTAGTAGAGCGAGGTTTTCACC
Reviews

Customers who bought this product also purchased
Z18039
Z18039
BY337
BY337
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
BY2606
BY2606
ZP80
ZP80
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies