Top » Catalog » SNPs » A10103

$18.00

A10103
[A10103]

A10103
hg38 Position: ChrY:8067371..8067371
Ancestral: A
Derived: T
Reference: Alex Williamson (2015)
ISOGG Haplogroup: R1b
Comments: Below DF49
Forward Primer: A10103_F ACAACGCTAATTCTTATTCTACAAACTG
Reverse Primer: A10103_R TTTTAGTAGAGCGAGGTTTTCACC
Reviews

Customers who bought this product also purchased
Z18039
Z18039
BY337
BY337
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
BY2606
BY2606
ZP80
ZP80
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies