Top » Catalog » SNPs » A10103

$18.00

A10103
[A10103]

A10103
HG19 Position: ChrY:7935412..7935412
Ancestral: A
Derived: T
Reference: Alex Williamson (2015)
ISOGG Haplogroup: R1b
Comments: Below DF49
Forward Primer: A10103_F ACAACGCTAATTCTTATTCTACAAACTG
Reverse Primer: A10103_R TTTTAGTAGAGCGAGGTTTTCACC
Reviews

Customers who bought this product also purchased
Z39589
Z39589
Z2961
Z2961
A11232
A11232
DF13
DF13
Z2980
Z2980
BY838
BY838
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies