Top » Catalog » SNPs » A10103

$18.00

A10103
[A10103]

A10103
HG19 Position: ChrY:7935412..7935412
Ancestral: A
Derived: T
Reference: Alex Williamson (2015)
ISOGG Haplogroup: R1b
Comments: Below DF49
Forward Primer: A10103_F ACAACGCTAATTCTTATTCTACAAACTG
Reverse Primer: A10103_R TTTTAGTAGAGCGAGGTTTTCACC
Reviews

Customers who bought this product also purchased
DF13
DF13
Z2980
Z2980
BY838
BY838
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
M222
M222
Z18039
Z18039
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies