Top » Catalog » SNPs » A11231

$18.00

A11231
[A11231]

A11231
HG19 Position: ChrY:8336793..8336793
Ancestral: C
Derived: G
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: M222 > DF105 > DF85 > DF97 > A1330 > A11230
Forward Primer: A11231_F AGGTTGATGTACATGAGTGATATGG
Reverse Primer: A11231_R GGCAGAAGAGTCATATCATTTTAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11602
1 x A1081
1 x A11016
1 x A10092
$72.00
Haplogroup Info
Other products
Currencies