Top » Catalog » SNPs » PF4881

$18.00

PF4881
[PF4881]

PF4881
hg38 Position: ChrY:20815121..20815121
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J1
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF4881_F CCAAAACACCCAGAAAATGG
Reverse Primer: PF4881_R CAAGTCCACTGGTTGGAAGG
Reviews

Customers who bought this product also purchased
ZS3698
ZS3698
Z1889
Z1889
L862
L862
FGC5
FGC5
ZS3668
ZS3668
Y136165
Y136165
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies