Top » Catalog » SNPs » PF4881

$19.00

PF4881
[PF4881]

PF4881
hg38 Position: ChrY:20815121..20815121
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J1
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF4881_F CCAAAACACCCAGAAAATGG
Reverse Primer: PF4881_R CAAGTCCACTGGTTGGAAGG
Reviews

Customers who bought this product also purchased
ZS1713
ZS1713
ZS4846
ZS4846
ZS1706
ZS1706
Y64437
Y64437
ZS1711
ZS1711
ZS7074
ZS7074
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies