Top » Catalog » SNPs » Z18243

$18.00

Z18243
[Z18243]

Z18243
hg38 Position: ChrY:15780950..15780950
Ancestral: G
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y samples 278174; 220756; 272200; downstream FGC1698
Forward Primer: Z18243_F CTTAGTTTCATTTTGTCATGAAATTCAC
Reverse Primer: Z18243_R CAAACTTCTGGGTATTCATTTCTCTG
Reviews

Customers who bought this product also purchased
FGC1723
FGC1723
ZS4960
ZS4960
FGC4415
FGC4415
Z18257
Z18257
BY4
BY4
ZS2272
ZS2272
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies