Top » Catalog » SNPs » ZS8485

$18.00

ZS8485
[ZS8485]

ZS8485
hg38 Position: ChrY:14202470..14202470
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: downstream FGC8806
Forward Primer: ZS8485_F CCACAGCCCAAGACTTTACC
Reverse Primer: ZS8485_R CCTGTCACTTGATGGAGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies