Top » Catalog » SNPs » A10698

$18.00

A10698
[A10698]

A10698
HG19 Position: ChrY:6946583..6946583
Ancestral: C
Derived: T
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I1-Z140 Z141+ [13] A1603+ Branch
Forward Primer: A10698_F ATTTGCATTTGACCCTGGAC
Reverse Primer: A10698_R GCCAACATAGTGAAATTCTGTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies