Top » Catalog » SNPs » A11309

$18.00

A11309
[A11309]

A11309
HG19 Position: ChrY:7776899..7776899
Ancestral: A
Derived: G
Reference: Zachary Gordon (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: Below M34 > L791 > Y6923 > Y15561
Forward Primer: A11309_F CATCCTGACACTTATAATACTGCTGC
Reverse Primer: A11309_R TAGCTGGCCATAGTGGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies