Top » Catalog » SNPs » A11309

$18.00

A11309
[A11309]

A11309
HG19 Position: ChrY:7908858..7908858
Ancestral: A
Derived: G
Reference: Zachary Gordon (2016)
ISOGG Haplogroup: E1b1b1b2a1a4d2c2~
Comments: Below M34 > L791 > Y6923 > Y15561
Forward Primer: A11309_F CATCCTGACACTTATAATACTGCTGC
Reverse Primer: A11309_R TAGCTGGCCATAGTGGTGG
Reviews

Customers who bought this product also purchased
A11310
A11310
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10684
1 x A10253
1 x A10293
1 x A10740
$72.00
Haplogroup Info
Other products
Currencies