Top » Catalog » SNPs » ZS6579

$18.00

ZS6579
[ZS6579]

ZS6579
hg38 Position: ChrY:7969363..7969363
Ancestral: A
Derived: G
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: downstream FGC4381
Forward Primer: ZS6579_F GTGTGACAATGGCATCATCC
Reverse Primer: ZS6579_R GTGGTCATTCTTCCTGCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ZS8820
1 x ZS6384
1 x ZS674
1 x ZS6311
1 x ZS8568
$90.00
Haplogroup Info
Other products
Currencies