Top » Catalog » SNPs » A11361

$17.50

A11361
[A11361]

A11361
HG19 Position: ChrY:7749920..7749920
Ancestral: C
Derived: G
Reference: Iain Kennedy (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below A725
Forward Primer: A11361_F AACCAAATCACTCATGAATCAGG
Reverse Primer: A11361_R TCTGTGCTCAGAATCCAGGTAAC
Reviews

Customers who bought this product also purchased
A11362
A11362
A11360
A11360
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies