Top » Catalog » SNPs » A11363

$17.50

A11363
[A11363]

A11363
HG19 Position: ChrY:14445064..14445064
Ancestral: C
Derived: A
Reference: Richard Cameron (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1335 > S691 > S695
Forward Primer: A11363_F CCATGGTTGTGCTACAACTGTC
Reverse Primer: A11363_R TCACTGCAGAGGATTACAGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies