Top » Catalog » SNPs » A11363

$18.00

A11363
[A11363]

A11363
HG19 Position: ChrY:12324337..12324337
Ancestral: C
Derived: A
Reference: Richard Cameron (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1335 > S691 > S695
Forward Primer: A11363_F CCATGGTTGTGCTACAACTGTC
Reverse Primer: A11363_R TCACTGCAGAGGATTACAGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10639
1 x A10755
1 x A1158
1 x A11512
1 x A10685
1 x A10930
1 x A10312
1 x A11653
1 x A11396
1 x A10151
1 x A11081
1 x A11414
1 x A11501
$234.00
Haplogroup Info
Other products
Currencies