Top » Catalog » SNPs » A11364

$18.00

A11364
[A11364]

A11364
hg38 Position: ChrY:20029836..20029836
Ancestral: A
Derived: C
Reference: Richard Cameron (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1335 > S691 > S695
Forward Primer: A11364_F CATGTTAGTGAATTCCTGAAATCTG
Reverse Primer: A11364_R CCATTTTGGATTGACCAACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies