Top » Catalog » SNPs » A11365

$18.00

A11365
[A11365]

A11365
HG19 Position: ChrY:10632798..10632798
Ancestral: C
Derived: T
Reference: Richard Cameron (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1335 > S691 > S695
Forward Primer: A11365_F CAGTGGCACAATATCAGCATG
Reverse Primer: A11365_R CCTGCGTGACATAGTGAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10027
1 x A10270
1 x A10510
1 x A10584
1 x A11207
1 x A10293
1 x A10158
1 x A10852
1 x A11304
1 x A11648
1 x A11088
$198.00
Haplogroup Info
Other products
Currencies