Top » Catalog » SNPs » A11365

$18.00

A11365
[A11365]

A11365
HG19 Position: ChrY:10632798..10632798
Ancestral: C
Derived: T
Reference: Richard Cameron (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1335 > S691 > S695
Forward Primer: A11365_F CAGTGGCACAATATCAGCATG
Reverse Primer: A11365_R CCTGCGTGACATAGTGAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10527
1 x A11664
1 x A10303
1 x A10729
$72.00
Haplogroup Info
Other products
Currencies