Top » Catalog » SNPs » A11367

$18.00

A11367
[A11367]

A11367
HG19 Position: ChrY:15559281..15559281
Ancestral: T
Derived: C
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11367_F AAGGGTTTATGGGTACCAAATTG
Reverse Primer: A11367_R GAGGATAGGCTGGAGGTATCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11534
1 x A11498
$36.00
Haplogroup Info
Other products
Currencies