Top » Catalog » SNPs » A11370

$18.00

A11370
[A11370]

A11370
hg38 Position: ChrY:26587070..26587070
Ancestral: T
Derived: C
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11370_F GGTCTCGTGGTGAAAGTGATG
Reverse Primer: A11370_R CACCTGTTTTTCCAGCATCTAGTAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies