Top » Catalog » SNPs » A11374

$16.00

A11374
[A11374]

A11374
HG19 Position: ChrY:22902199..22902199
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Below PF4135
Forward Primer: A11374_F AAATTAGCTGGACGTGGTGG
Reverse Primer: A11374_R GGAAGGCAAGTGAATAATTCATG
Reviews

Customers who bought this product also purchased
Y11772
Y11772
A13664
A13664
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies