Top » Catalog » SNPs » A11374

$18.00

A11374
[A11374]

A11374
HG19 Position: ChrY:22902199..22902199
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Below PF4135
Forward Primer: A11374_F AAATTAGCTGGACGTGGTGG
Reverse Primer: A11374_R GGAAGGCAAGTGAATAATTCATG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Y11772
Y11772
A13664
A13664
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies