Top » Catalog » SNPs » A11375

$18.00

A11375
[A11375]

A11375
hg38 Position: ChrY:12491102..12491102
Ancestral: A
Derived: C
Reference: Ray Warburton (2016)
ISOGG Haplogroup: R1b1a1a2a (not listed)
Comments: Downstream of L151
Forward Primer: A11375_F ACACACATGAGGCTGCTGTC
Reverse Primer: A11375_R GGATCCCAGAACACAAGGG
Reviews

Customers who bought this product also purchased
A11379
A11379
A11378
A11378
A11377
A11377
A11376
A11376
A8050
A8050
R1b-S6881 Panel
R1b-S6881 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies