Top » Catalog » SNPs » A11377

$16.00

A11377
[A11377]

A11377
HG19 Position: ChrY:17011572..17011572
Ancestral: C
Derived: G
Reference: Ray Warburton (2016)
ISOGG Haplogroup: R1b1a1a2a (not listed)
Comments: Downstream of L151
Forward Primer: A11377_F CTGTTAATCCACCACTCACATCAG
Reverse Primer: A11377_R CAAATGCATGGAACTCTACTCG
Reviews

Customers who bought this product also purchased
R1b-S6881 Panel
R1b-S6881 Panel
S6881
S6881
A11379
A11379
A11378
A11378
A11376
A11376
A11375
A11375
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies