Top » Catalog » SNPs » A11377

$18.00

A11377
[A11377]

A11377
hg38 Position: ChrY:14899692..14899692
Ancestral: C
Derived: G
Reference: Ray Warburton (2016)
ISOGG Haplogroup: R1b1a1a2a (not listed)
Comments: Downstream of L151
Forward Primer: A11377_F CTGTTAATCCACCACTCACATCAG
Reverse Primer: A11377_R CAAATGCATGGAACTCTACTCG
Reviews

Customers who bought this product also purchased
Prepaid Return Envelope
Prepaid Return Envelope
MZ7
MZ7
FGC11780
FGC11780
DNA Sample Kit
DNA Sample Kit
BZ2
BZ2
CTS7080
CTS7080
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies