Top » Catalog » SNPs » A11378

$18.00

A11378
[A11378]

A11378
HG19 Position: ChrY:17050563..17050563
Ancestral: G
Derived: A
Reference: Ray Warburton (2016)
ISOGG Haplogroup: R1b1a1a2a (not listed)
Comments: Downstream of L151
Forward Primer: A11378_F TTCAGGGAGTATATGTATTGCCC
Reverse Primer: A11378_R TCAAAGAGCTTCCCATAATATTTAGG
Reviews

Customers who bought this product also purchased
A15057
A15057
A15056
A15056
A15055
A15055
A15054
A15054
A15060
A15060
R1b-A11378 Panel
R1b-A11378 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11111
1 x A117
1 x A11125
$54.00
Haplogroup Info
Other products
Currencies