Top » Catalog » SNPs » A11378

$18.00

A11378
[A11378]

A11378
hg38 Position: ChrY:17050563..17050563
Ancestral: G
Derived: A
Reference: Ray Warburton (2016)
ISOGG Haplogroup: R1b1a1a2a (not listed)
Comments: Downstream of L151
Forward Primer: A11378_F TTCAGGGAGTATATGTATTGCCC
Reverse Primer: A11378_R TCAAAGAGCTTCCCATAATATTTAGG
Reviews

Customers who bought this product also purchased
A15058
A15058
A15057
A15057
A15056
A15056
A15055
A15055
A15054
A15054
A15060
A15060
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies