Top » Catalog » SNPs » A11379

$18.00

A11379
[A11379]

A11379
HG19 Position: ChrY:23999089..23999089
Ancestral: C
Derived: A
Reference: Ray Warburton (2016)
ISOGG Haplogroup: R1b1a1a2a (not listed)
Comments: Downstream of L151
Forward Primer: A11379_F GCGTGTTCCGTCTGACAG
Reverse Primer: A11379_R ACACAGCTTGCACACGTACTG
Reviews

Customers who bought this product also purchased
A11376
A11376
A11375
A11375
A8050
A8050
R1b-S6881 Panel
R1b-S6881 Panel
S6881
S6881
A11378
A11378
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies