Top » Catalog » SNPs » A11379

$18.00

A11379
[A11379]

A11379
hg38 Position: ChrY:21852942..21852942
Ancestral: C
Derived: A
Reference: Ray Warburton (2016)
ISOGG Haplogroup: R1b1a1a2a (not listed)
Comments: Downstream of L151
Forward Primer: A11379_F GCGTGTTCCGTCTGACAG
Reverse Primer: A11379_R ACACAGCTTGCACACGTACTG
Reviews

Customers who bought this product also purchased
S6881
S6881
A11378
A11378
A11377
A11377
A11376
A11376
A11375
A11375
A8050
A8050
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies