Top » Catalog » SNPs » A11381

$18.00

A11381
[A11381]

A11381
HG19 Position: ChrY:19515453..19515453
Ancestral: T
Derived: C
Reference: Kirill Prokopyuk (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A11381_F GCTGAACTAGTAGCCAACTTCTGG
Reverse Primer: A11381_R TTTATGGCAAAAGAATCTGGGT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies