Top » Catalog » SNPs » A11382

$18.00

A11382
[A11382]

A11382
HG19 Position: ChrY:22946994..22946994
Ancestral: C
Derived: T
Reference: Kirill Prokopyuk (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A11382_F CATATGCCTACCAGTGCACG
Reverse Primer: A11382_R CCCCAAAAGTCCATTCTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies