Top » Catalog » SNPs » A11382

$18.00

A11382
[A11382]

A11382
HG19 Position: ChrY:20785108..20785108
Ancestral: C
Derived: T
Reference: Kirill Prokopyuk (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A11382_F CATATGCCTACCAGTGCACG
Reverse Primer: A11382_R CCCCAAAAGTCCATTCTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10639
1 x A10755
1 x A1158
1 x A11512
1 x A10685
1 x A10930
1 x A10312
1 x A11653
1 x A11396
1 x A10151
1 x A11081
1 x A11414
1 x A11501
$234.00
Haplogroup Info
Other products
Currencies