Top » Catalog » SNPs » A11385

$17.50

A11385
[A11385]

A11385
HG19 Position: ChrY:18597316..18597316
Ancestral: T
Derived: C
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11385_F TGCAACCATTTAAAATACATGGC
Reverse Primer: A11385_R AGACAGATGTCCAACAAAATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies